Q J Med 2000; 93: 269-275
© 2000 Association of Physicians
Curative hepatorenal transplantation in systemic amyloidosis caused by the Glu526Val fibrinogen 
-chain variant in an English family
From the Centre for Amyloidosis & Acute Phase Proteins, Department of Medicine, Royal Free and University College Medical School, Royal Free Campus, 1 Institute of Liver Studies, King's College School of Medicine, London, and 2 Department of Nephrology, St Mary's Hospital Portsmouth, UK
Received 21 January 2000 and in revised form 13 March 2000
 |
Summary |
|---|
 Top Summary IntroductionMethodsResultsDiscussionReferences |
|---|
A 53-year-old English woman who had been thought to have systemic monoclonal immunoglobulin light chain (AL) amyloidosis was investigated further because of her unusually long 17-year history and a suggestion of renal disease in the family. She was found to have the Glu526Val fibrinogen
-chain variant that causes autosomal dominant hereditary systemic amyloidosis. This has not previously been described in a British family. The mutant gene was associated with the same haplotype as in all other reported cases, suggesting a common founder. The patient had already received a renal transplant, but the graft failed within 6 years due to amyloid deposition. Progressive hepatic amyloidosis eventually caused liver failure, although the function of other organs was well preserved. She therefore received hepatic and renal transplants to replace the failed organs and the hepatic source of the amyloidogenic variant fibrinogen. Three years later she is completely well and has no amyloid deposits identifiable by serum amyloid P component scintigraphy. This is the first detailed report of hepatic transplantation for liver failure caused by amyloidosis of any type. The substantial follow-up suggests that fibrinogen -chain amyloidosis is one of the inherited metabolic diseases that can be cured by liver transplantation. The mutation underlying Glu526Val fibrinogen -chain amyloidosis is incompletely penetrant and has a variable phenotype that can clinically mimic AL amyloidosis. Hereditary fibrinogen amyloidosis may be more prevalent than previously suspected and, since AL amyloid is sometimes a diagnosis of exclusion, genotyping for other amyloidogenic proteins is mandatory in all cases in which the amyloid fibrils cannot be positively identified as AL. |
Introduction |
|---|
|
TopSummaryIntroductionMethodsResultsDiscussionReferences |
|---|
Systemic amyloidosis is a progressive multisystem disorder with a poor prognosis which may be acquired or hereditary.1. The acquired forms are AL type, arising in patients with clonal plasma cell dyscrasias, and AA type, that complicates chronic inflammatory diseases. Hereditary amyloidosis is rare and usually has a major neuropathic component. However, hereditary non-neuropathic systemic amyloidosis is a distinct syndrome associated in different kindreds with mutations in the genes for apolipoprotein AI,2–8 lysozyme9 and fibrinogen
-chain,10–14 resulting in deposition of amyloid fibrils derived from the respective variant proteins. These autosomal dominant disorders usually present with renal impairment in middle age. Although there is no specific therapy for amyloidosis, treatments which substantially reduce the supply of the amyloid fibril precursor protein can be extremely effective in preventing disease progression, preserving organ function and improving survival,15 and histological regression of amyloid has been well documented.16 These observations have lately been confirmed and extended in more than 1000 patients using serial quantitative radiolabelled serum amyloid P component (SAP) scintigraphy, which has systematically demonstrated in vivo the turnover and regression of all types of amyloid studied.17
Fibrinogen -chain amyloidosis has previously been reported in eight kindreds, five of which were of European ancestry and were associated with the Glu526Val variant. These patients have hitherto received only supportive treatment, including dialysis for end-stage renal failure and, in a few cases, renal transplantation. However, progressive amyloid deposition can cause renal graft failure or lead to clinically significant amyloid involvement of other organ systems. We report here the first English family with fibrinogen -chain Glu526Val amyloidosis and describe the remarkable recovery and probable cure of the proband following combined liver and kidney transplantation.
|
Methods |
|---|
|
TopSummaryIntroductionMethodsResultsDiscussionReferences |
|---|
Patient
A Caucasian woman of English ancestry presented with nephrotic syndrome and renal failure in 1983, aged 36 years. Renal biopsy revealed amyloid which, in the absence of any underlying inflammatory disease or obvious family history, was thought to be of AL type. Tests of blood coagulation were normal. She progressed rapidly to end-stage renal failure and was haemodialysed. A successful renal transplant was performed in 1987, but the graft failed in 1993 due to recurrent amyloidosis. Haemodialysis was reinstituted, and her condition remained relatively stable until 1995, when she began to lose weight in association with increasing hepatomegaly and abdominal pain. When she was first evaluated in our Unit, in 1996, she was cachectic and had progressive liver failure. However there was no evidence of cardiac amyloidosis, and neither a paraprotein nor a monoclonal plasma cell population could be identified. The amyloid fibril protein could not be identified immunohistochemically, but although these findings remained consistent with AL amyloidosis, her unusually long survival prompted further enquiries. The fact that her father had had renal disease when he died at the age of 66 years suggested additional investigations to exclude the possibility of hereditary amyloidosis.
Histology
The only tissue available from the patient was a wax-embedded biopsy of nasal mucosa obtained following an epistaxis. Amyloid was identified in 6-µm tissue sections stained with Congo red by demonstration of the pathognomonic red-green birefringence when viewed under cross-polarized light. Immunohistochemical stains were performed on sections that contained amyloid as described previously9 using commercial polyclonal antisera (Dako Ltd and Medix) against the following known amyloid fibril proteins: 
and 
immunoglobulin light chains, serum amyloid A protein, apolipoprotein AI, lysozyme, transthyretin and fibrinogen. Control tissues containing each of these types of amyloid were stained at the same time, except in the case of fibrinogen -chain in which a fixed fibrin clot was used as substrate.
Radiolabelled serum amyloid P component scintigraphy
Whole-body scintigraphic imaging was performed after administration of 123I-labelled SAP, as previously described.18 Anterior and posterior whole-body scans and regional images were obtained with an IGE Starcam gamma camera 24 h after intravenous injection of 123I-SAP. The administered dose was 200 MBq of activity associated with 100 µg of pure protein, giving an effective dose equivalent of ~3 mSv.
Genotyping
DNA was isolated as previously described from the patient's whole blood taken into EDTA.3 Primers were designed to amplify the portion of the fibrinogen -chain gene which flanked the coding region for the peptide fragment that had previously been identified as the fibril subunit in hereditary fibrinogen -chain amyloidosis.10 The primers were: TGATGAAGCTGCCTTCTTCGA (nucleotides 4817–4837) and CTCATCTGCCATTTTATAGCT (nucleotides 5047– 5093), which amplified a fragment of 277 base pairs (GenBank accession no. M64982). PCR solutions and cycling conditions were as described previously19 except that a melting temperature of 56°C was used. The PCR product was gel fractionated, purified and sequenced directly as previously described.19 In addition, the genes for lysozyme,9 transthyretin19 and apolipoprotein AI3 were amplified and sequenced in the patient.
RFLP analysis
The mutation identified in the fibrinogen -chain gene results in the loss of a DdeI site and an HinfI site. The PCR product was digested with these enzymes and the fragments were fractionated on an 8% polyacrylamide gel and silver-stained.
Haplotype analysis of the fibrinogen -chain gene
The fragment of the gene encoding both the Val526 mutation and a polymorphic repeat sequence upstream from it20 were amplified by PCR using primers Fib3, ATCGGCTTCACTTCCGGC, and Fib4, CCATAGGTTTTGAACTCACAG, and the Boehringer Mannheim PCR Expand system (Roche). Cycling conditions were a denaturing step of 94°C for 5 min, then 10 cycles of 94°C for 1 min, 58°C for 30 s, and 68°C for 2 min, then 10 cycles of 94°C for 1 min, 58°C for 30 s, and 68°C for 3 min, then 10 cycles of 94°C for 1 min, 58°C for 30 s, and 68°C for 4 min. This was followed by an elongation step of 68°C for 7 min. The PCR product was cloned into pGEMt (Promega) and four clones were sequenced.
|
Results |
|---|
|
TopSummaryIntroductionMethodsResultsDiscussionReferences |
|---|
Histology
The extensive amyloid deposits in the patient's nasal biopsy did not react with antisera to serum amyloid A protein, apolipoprotein AI, lysozyme, transthyretin,
or immunoglobulin light chains or fibrinogen.
SAP scintigraphy
Radiolabelled SAP scintigraphy and turnover studies in the patient showed that more than 95% of the injected tracer localized to her massive amyloidotic liver and spleen, representing a very large whole-body amyloid load, and preventing evaluation of uptake in adjacent organs (Figure 1
).
|
DNA analysis
The patient was heterozygous for an A to T transversion at nucleotide 4909 in the sequence of the gene for fibrinogen -chain. This changes codon 526 from GAG, encoding glutamic acid, to GTG, encoding valine (GTG) (Figure 2). The presence of the mutation, which causes loss of both a DdeI (CTNAG) and an HinfI restriction site (GANTC), was corroborated by RFLP analysis (Figure 3). The genes for lysozyme, transthyretin and apolipoprotein AI were of normal wild-type sequence. Haplotype analysis revealed that the mutation in the fibrinogen -chain gene was on the B5 allele,13 which has 13 TCTT repeats.
|
|
Combined hepatorenal transplantation
In order to both replace failed organ function and remove the source of the amyloidogenic variant fibrinogen -chain protein, the patient underwent combined liver and kidney transplantation on 15 October, 1996. There were no complications and she was discharged from hospital with normal renal and liver function 14 days later. After 36 months of follow-up, she has gained 20 kg in weight, is leading a fully active life and has no symptoms. No amyloid deposits could be identified on whole-body SAP scintigraphy performed 18 months after surgery or on scans repeated every 6 months thereafter (Figure 1
).
|
Discussion |
|---|
|
TopSummaryIntroductionMethodsResultsDiscussionReferences |
|---|
The unexpected aetiology and gratifying outcome of our case highlight important aspects in the clinical management of patients with systemic amyloidosis in general. It is essential to characterize the amyloid fibril type in every case, and to recognize the shortcomings of the techniques commonly used to do this. Until specific anti-amyloid drugs become available, the two chief objectives of treatment in amyloidosis are to reduce the supply of the amyloid fibril precursor protein, in the hope that progression of the disease will be retarded, whilst using supportive therapy, including renal dialysis and organ transplantation, to replace failing organ function.15 By elucidating the molecular basis of our patient's disease, we were uniquely able to offer her a single therapeutic procedure that achieved both objectives in full. The remarkably successful outcome supports the indication for liver transplantation in the management of this inherited metabolic disease and is the first detailed report of liver transplantation for end-stage hepatic failure in systemic amyloidosis.
The presentation of our patient with renal amyloid in her fourth decade without any prior history of illness strongly suggested a diagnosis of systemic AL amyloidosis. The monoclonal plasma cell dyscrasias that underlie this disease are usually subtle, and are completely undetectable in up to 15% of cases. The definitive technique for typing amyloid fibril proteins is direct amino-acid sequencing in vitro, but the isolation of fibrils generally requires substantial amounts of tissue available only after surgical resection or at autopsy. Immunohistochemical staining of biopsies with antibodies against known amyloidogenic proteins is therefore the routine method but, while AA amyloid deposits can be identified in all cases, a substantial proportion of AL deposits cannot be stained.21 Thus AL amyloidosis is frequently a diagnosis of exclusion, based on the clinical presentation and negative immunohistochemical stains for AA and other known amyloid proteins. Although the demonstration of a monoclonal gammopathy supports the diagnosis of AL amyloidosis, subtle plasma cell dyscrasias are not uncommon in the general population, and may therefore be an incidental finding. Accurate diagnosis in AL amyloidosis is increasingly important because of the widespread adoption of intensive chemotherapy22 and peripheral blood stem cell transplantation23,24 which are associated with substantial treatment-related morbidity and mortality. The features in our patient that led us to question the diagnosis of AL amyloid were her very long survival without treatment, and the lack of an identifiable monoclonal gammopathy or any features restricted to AL such as macroglossia or widespread bony amyloid visualized on SAP scintigraphy. A comprehensive family history should be sought routinely in amyloidosis, and a vague story of renal impairment in our patient's elderly father suggested the possibility of hereditary disease. Although immunohistochemistry can usually identify the fibril protein in hereditary systemic amyloidosis of apolipoprotein AI and lysozyme types, we have thus far only achieved equivocal staining of Glu526Val fibrinogen -chain amyloid deposits using commercially available antibodies to fibrinogen.
Unfortunately, our patient's whole explanted liver was not available for technical reasons, so that we were unable to isolate and characterize her amyloid fibrils. Nevertheless the evidence that her amyloid deposits were of fibrinogen -chain type is very strong. Firstly, the Glu526Val fibrinogen -chain variant has now been reported in association with major systemic amyloidosis in six families, and it has not been found in the healthy population. Secondly, three other mutations that cause hereditary amyloidosis have been identified in the same region of the fibrinogen -chain gene, and amyloid fibrils composed of part of the corresponding variant fibrinogen -chain have lately been isolated from a patient with one of these mutations.14 Thirdly, the complete regression of amyloid deposits in other organs of our patient following liver transplantation is consistent only with her own liver having been the source of the amyloidogenic protein. Most reported patients with amyloidosis caused by the Glu526Val fibrinogen -chain variant have presented with renal amyloid in middle age, although extensive multi-system amyloid deposits have been described at autopsy. However, our present findings show that the onset and course of the disease can vary substantially even between first-degree relatives, just as in apoA-I, lysozyme and transthyretin amyloidosis.25–27
In systemic amyloidosis, solid organ transplantation has been used chiefly to replace failing renal function,15 although some cardiac transplants have also been performed.8,28 Unless the supply of the amyloid fibril precursor protein can be reduced, recurrent amyloid deposition in transplanted organs must be anticipated, although it may occur relatively slowly. Renal transplantation alone has been performed for end-stage renal failure in several patients with fibrinogen -chain amyloidosis, and probably remains appropriate when there is good evidence that amyloid deposition does not threaten the function of other vital organs. Major hepatic amyloidosis, however, is always associated with extensive multi-system amyloid involvement29 and the role of transplantation just to treat amyloidotic liver failure remains far from clear. Of the few such transplants performed, one was in an American patient with fibrinogen -chain amyloidosis (unpublished report by Dr M.D. Benson at VIII International Symposium on Amyloidosis, 1998), but systematic follow-up and outcome have not been reported. On the other hand, orthotopic liver transplantation has been used widely as a form of ‘surgical gene therapy’ in patients with familial amyloid polyneuropathy caused by transthyretin mutations.30,31 Although the liver is the main site of variant transthyretin production in these patients, significant amyloid deposition does not occur in the liver itself, and livers explanted from these patients have even been re-utilized in selected domino transplant procedures.32 The liver in our patient with fibrinogen -chain amyloidosis was both the site of production of the fibril precursor protein and the most serious site of amyloid deposition. Since there is no evidence that wild-type fibrinogen -chain is amyloidogenic, orthotopic hepatic transplantation is potentially curative in this situation. Serial SAP scintigraphy has confirmed that systemic amyloid deposits of AA, AL and variant TTR types gradually regress in the majority of patients in whom the underlying primary conditions have been corrected.15,17,33,34 Although we predicted the regression of residual fibrinogen -chain amyloid deposits following hepatorenal transplantation in our patient, the extent and speed with which this occurred was remarkable. The kidney transplanted from the same donor as the liver may also be less prone to chronic long-term rejection than isolated renal grafts.35
Finally, since there are many patients in whom the clinical diagnosis of systemic AL amyloidosis cannot be proven definitively and the family history of hereditary amyloidosis can be obscured by variable penetrance, it is possible that the present mutation may be more common than has so far been recognized. This is supported by our confirmation that all the known kindreds with the Glu526Val fibrinogen -chain variant, comprising English, Irish, German and Polish families, share the same uncommon haplotype and thus may have a common founder.13 DNA analysis is therefore mandatory, regardless of the family history, in all patients with systemic non-AA amyloidosis in whom AL amyloid has not been positively confirmed.
|
Acknowledgments |
|---|
This work was supported by MRC Programme Grant G97900510 to MBP and PNH and by NHS Research and Development funds. JDG holds a Wellcome Trust Clinical Training Fellowship. We thank Beth Jones for expert preparation of the manuscript.
|
Notes |
|---|
Address correspondence to Dr J.D. Gillmore, Centre for Amyloidosis and Acute Phase Proteins, Royal Free and University College Medical School, Royal Free Campus, Rowland Hill Street, London NW3 2PF. e-mail: j.gillmore{at}rfc.ucl.ac.uk
|
References |
|---|
|
TopSummaryIntroductionMethodsResultsDiscussionReferences |
|---|
1. Pepys MB. Amyloidosis. In: Weatherall DJ, Ledingham JGG, Warrell DA, eds. Oxford Textbook of Medicine, 3rd edn. Oxford, Oxford University Press, 1995:1512–24.
2. Jones LA, Harding JA, Cohen AS, Skinner M. New USA family has apolipoprotein AI (Arg26) variant. In: Natvig JB, Førre Ø, Husby G, Husebekk A, Skogen B, Sletten K, Westermark P, eds. Amyloid and Amyloidosis 1990. Dordrecht, Kluwer Academic Publishers, 1991:385–8.
3.
Soutar AK, Hawkins PN, Vigushin DM, Tennent GA, Booth SE, Hutton T, Nguyen O, Totty NF, Feest TG, Hsuan JJ, Pepys MB. Apolipoprotein AI mutation Arg-60 causes autosomal dominant amyloidosis. Proc Natl Acad Sci USA1992; 89:7389–93.
4. Booth DR, Tan SY, Booth SE, Hsuan JJ, Totty NF, Nguyen O, Tennent GA, Hutchinson WL, Vigushin DM, Thomson N, Soutar AK, Hawkins PN, Pepys MB. Hereditary renal amyloidosis caused by a new apolipoprotein AI variant, Trp50Arg. Nephrol Dial Transplant1995; 10:943.
5. Booth DR, Tan SY, Booth SE, Tennent GA, Hutchinson WL, Hsuan JJ, Totty NF, Nguyen O, Soutar AK, Hawkins PN, Bruguera M, Caballería J, Solé M, Campistol JM, Pepys MB. Hereditary hepatic and systemic amyloidosis caused by a new deletion/insertion mutation in the apolipoprotein AI gene. J Clin Invest1996; 97:2714–21.[Web of Science][Medline]
6. Hamidi Asl K, Liepnieks JJ, Nakamura M, Parker F, Benson MD. A novel apolipoprotein A-1 variant, Arg173Pro, associated with cardiac and cutaneous amyloidosis. Biochem Biophys Res Commun1999; 257:584–8.[Web of Science][Medline]
7.
Hamidi Asl L, Liepnieks JJ, Hamidi Asl K, Uemichi T, Moulin G, Desjoyaux E, Loire R, Delpech M, Grateau G, Benson MD. Hereditary amyloid cardiomyopathy caused by a variant apolipoprotein A1. Am J Pathol1999; 154:221–7.
8.
Obici L, Bellotti V, Mangione P, Stoppini M, Arbustini E, Verga L, Zorzoli I, Anesi E, Zanotti G, Campana C, Viganò M, Merlini G. The new apolipoprotein A-I variant Leu174
Ser causes hereditary cardiac amyloidosis, and the amyloid fibrils are constituted by the 93-residue N-terminal polypeptide. Am J Pathol1999; 155:695–702.
9. Pepys MB, Hawkins PN, Booth DR, Vigushin DM, Tennent GA, Soutar AK, Totty N, Nguyen O, Blake CCF, Terry CJ, Feest TG, Zalin AM, Hsuan JJ. Human lysozyme gene mutations cause hereditary systemic amyloidosis. Nature1993; 362:553–7.[Medline]
10. Benson MD, Liepnieks J, Uemichi T, Wheeler G, Correa R. Hereditary renal amyloidosis associated with a mutant fibrinogen a-chain. Nature Gen1993; 3:252–5.[Web of Science][Medline]
11. Uemichi T, Liepnieks JJ, Benson MD. Hereditary renal amyloidosis with a novel variant fibrinogen. J Clin Invest1994; 93:731–6.
12.
Uemichi T, Liepnieks JJ, Yamada T, Gertz MA, Bang N, Benson MD. A frame shift mutation in the fibrinogen A a-chain gene in a kindred with renal amyloidosis. Blood1996; 87:4197–203.
13.
Uemichi T, Liepnieks JJ, Alexander F, Benson MD. The molecular basis of renal amyloidosis in Irish-American and Polish-Canadian kindreds. Q J Med1996; 89:745–50.
14.
Hamidi Asl L, Liepnieks JJ, Uemichi T, Rebibou JM, Justrabo E, Droz D, Mousson C, Chalopin JM, Benson MD, Delpech M, Grateau G. Renal amyloidosis with a frame shift mutation in fibrinogen -chain gene producing a novel amyloid protein. Blood1997; 90:4799–805.
15. Tan SY, Pepys MB, Hawkins PN. Treatment of amyloidosis. Am J Kidney Dis1995; 26:267–85.[Web of Science][Medline]
16. Hawkins PN, Pepys MB. A primed state exists in vivo following histological regression of amyloidosis. Clin Exp Immunol1990; 81:325–8.[Web of Science][Medline]
17. Hawkins PN. Studies with radiolabelled serum amyloid P component provide evidence for turnover and regression of amyloid deposits in vivo. Clin Sci1994; 87:289–95.[Medline]
18. Hawkins PN, Lavender JP, Pepys MB. Evaluation of systemic amyloidosis by scintigraphy with 123I-labeled serum amyloid P component. N Engl J Med1990; 323:508–13.[Abstract]
19.
Booth DR, Tan SY, Hawkins PN, Pepys MB, Frustaci A. A novel variant of transthyretin, 59Thr-Lys, associated with autosomal dominant cardiac amyloidosis in an Italian family. Circulation1995; 91:962–7.
20.
Mills KA, Even D, Murray JC. Tetranucleotide repeat polymorphism at the human alpha fibrinogen locus (FGA). Hum Mol Genet1992; 1:779.
21. Tan SY, Pepys MB. Amyloidosis. Histopathology1994; 25:403–14.[Web of Science][Medline]
22. Persey MR, Lovat LB, Apperley JF, Madhoo S, Pepys MB, Hawkins PN. Intensive chemotherapy for AL amyloidosis. Br J Rheumatol1996; 35(Suppl. 1):12.
23. Moreau P, Leblond V, Bourquelot P, Facon T, Huynh A, Caillot D, Hermine O, Attal M, Hamidou M, Nedellec G, Ferrant A, Audhuy B, Bataille R, Milpied N, Harousseau JL. Prognostic factors for survival and response after high-dose therapy and autologous stem cell transplantation in systemic AL amyloidosis: a report on 21 patients. Br J Haematol1998; 101:766–9.[Web of Science][Medline]
24.
Comenzo RL, Vosburgh E, Falk RH, Sanchorawala V, Reisinger J, Dubrey S, Dember LM, Berk JL, Akpek G, LaValley M, O'hara C, Arkin CF, Wright DG, Skinner M. Dose-intensive melphalan with blood stem-cell support for the treatment of AL (amyloid light-chain) amyloidosis: survival and responses in 25 patients. Blood1998; 91:3662–70.
25. Persey MR, Booth DR, Booth SE, van Zyl-Smit R, Adams BK, Fattaar AB, Tennent GA, Hawkins PN, Pepys MB. Hereditary nephropathic systemic amyloidosis caused by a novel variant apolipoprotein A-I. Kidney Int1998; 53:276–81.[Web of Science][Medline]
26.
Gillmore JD, Booth DR, Madhoo S, Pepys MB, Hawkins PN. Hereditary renal amyloidosis associated with variant lysozyme in a large English family. Nephrol Dial Transplant1999; 14:2639–44.
27. Herbert J, Younger D, Latov N, Martone RL. Clinical spectrum of familial amyloidotic polyneuropathy. In: Kisilevsky R, Benson MD, Frangione B, Gauldie J, Muckle TJ, Young ID, eds. Amyloid and Amyloidosis 1993. Pearl River NY, Parthenon Publishing,1994:486–8.
28.
Hall R, Hawkins PN. Cardiac transplantation for AL amyloidosis: a personal account. Br Med J1994; 309:1135–7.
29.
Lovat LB, Persey MR, Madhoo S, Pepys MB, Hawkins PN. The liver in systemic amyloidosis: insights from 123I serum amyloid P component scintigraphy in 484 patients. Gut1998; 42:727–34.
30. Holmgren G, Ericzon B-G, Groth C-G, Steen L, Suhr O, Andersen O, Wallin BG, Seymour A, Richardson S, Hawkins PN, Pepys MB. Clinical improvement and amyloid regression after liver transplantation in hereditary transthyretin amyloidosis. Lancet1993; 341:1113–16.[Web of Science][Medline]
31. Steen L, Holmgren G, Suhr O, Wikström L, Groth C-G, Ericzon B-G. World-wide survey of liver transplantation in patients with familial amyloidotic polyneuropathy. Amyloid: Int J Exp Clin Invest1994; 1:138–42.
32. Stangou AJ, Heaton ND, Rela M, Pepys MB, Hawkins PN, Williams R. Domino hepatic transplantation using the liver from a patient with familial amyloid polyneuropathy. Transplantation1998; 65:1496–8.[Web of Science][Medline]
33. Rydh A, Suhr O, Hietala S-O, Åhlström KR, Pepys MB, Hawkins PN. Serum amyloid P component scintigraphy in familial amyloid polyneuropathy: regression of visceral amyloid following liver transplantation. Eur J Nucl Med1998; 25:709–13.[Web of Science][Medline]
34. Gillmore JD, Davies J, Iqbal A, Madhoo S, Russell NH, Hawkins PN. Allogeneic bone marrow transplantation for systemic AL amyloidosis. Br J Haematol1998; 100:226–8.[Web of Science][Medline]
35. Rasmussen A, Davies HF, Jamieson NV, Evans DB, Calne RY. Combined transplantation of liver and kidney from the same donor protects the kidney from rejection and improves kidney graft survival. Transplantation1995; 59:919–21.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. D. Gillmore, H. J. Lachmann, D. Rowczenio, J. A. Gilbertson, C.-H. Zeng, Z.-H. Liu, L.-S. Li, A. Wechalekar, and P. N. Hawkins Diagnosis, Pathogenesis, Treatment, and Prognosis of Hereditary Fibrinogen A{alpha}-Chain Amyloidosis J. Am. Soc. Nephrol., February 1, 2009; 20(2): 444 - 451. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Tennent, S. O. Brennan, A. J. Stangou, J. O'Grady, P. N. Hawkins, and M. B. Pepys Human plasma fibrinogen is synthesized in the liver Blood, March 1, 2007; 109(5): 1971 - 1974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J. Lachmann, D. R. Booth, S. E. Booth, A. Bybee, J. A. Gilbertson, J. D. Gillmore, M. B. Pepys, and P. N. Hawkins Misdiagnosis of Hereditary Amyloidosis as AL (Primary) Amyloidosis N. Engl. J. Med., June 6, 2002; 346(23): 1786 - 1791. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.J. Lachmann, J.A. Gilbertson, J.D. Gillmore, P.N. Hawkins, and M.B. Pepys Unicentric Castleman's disease complicated by systemic AA amyloidosis: a curable disease QJM, April 1, 2002; 95(4): 211 - 218. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||